View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9363_low_33 (Length: 251)
Name: NF9363_low_33
Description: NF9363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9363_low_33 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 15560990 - 15560757
Alignment:
| Q |
1 |
actataccgtcatcataatctcgtaagtacaactcatcgtatgataaaaggttgcaaaaacattatatattggaggcgagttcgatccgacaattcacca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||| |||||| |||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
15560990 |
actataccgtcatcataatctcgtaagtacaactcatcgtatggtaaaagattgcaagaacactatatattggaggcaagttcgatccgacaattcacca |
15560891 |
T |
|
| Q |
101 |
cttctcactatttagtatgtgtgagttttgccgttaaactttctaacagtaatattgtgacacaaatttcccatttgttttgcaaactacccaacttgtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15560890 |
cttctcactatttagtatgtgtgagttttgccgttaaactttttaacagtaatattgtgacacaaatttcccatttgttttgcaaactacccaacttgtt |
15560791 |
T |
|
| Q |
201 |
atggacatattatt-cttttataaaagtatgatt |
233 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
15560790 |
atggacatattattccttttataaaagtatgatt |
15560757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University