View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9363_low_37 (Length: 248)
Name: NF9363_low_37
Description: NF9363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9363_low_37 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 38 - 225
Target Start/End: Complemental strand, 43102875 - 43102688
Alignment:
| Q |
38 |
acaacgtttgcatccacgagagctcccatacacactcatcttcctcccagtactgtccaatctcccata---ccctaccattttgctgctatgaaacctt |
134 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
43102875 |
acaacgtttgcatccacgagagctcccatacacactcatcttcctcccagt---gtccaatctcccataataccctaccattttgctgctatgaaacctt |
43102779 |
T |
|
| Q |
135 |
aaatagtctttgatagtcaacctatcctcagtggcacacaaccaagtggaagatatgtatggatgataaccaaatttaggaggaccgccct |
225 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43102778 |
aaatagtctttgatagccaacctatcctcagtggcacacaaccaagtggaagatatgtatggatgataaccaaatttaggaggaccgccct |
43102688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University