View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9363_low_41 (Length: 241)
Name: NF9363_low_41
Description: NF9363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9363_low_41 |
 | |
|
| [»] scaffold0280 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0280 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: scaffold0280
Description:
Target: scaffold0280; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 17 - 230
Target Start/End: Complemental strand, 14449 - 14227
Alignment:
| Q |
17 |
attacctgtattgaagaaacccaattcaaagtttccatcattggagacaagagtttgatcaccagaaagagattggtttgatgagatgctggtcaaagca |
116 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14449 |
attacctttattgaagaaacccaattcaaagtttccatcattggagacaagagtttgatcaccagaaagagattggtttgatgagatgctggtcaaagca |
14350 |
T |
|
| Q |
117 |
gaaagtgaagggtaggtgtgtaaatagaataagatgatgagaagacaaagggagaacagtggttttttcttcatattgtt---------aatggtttggt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
14349 |
gaaagtgaagggtaggtgtgtaaatagaataagatgatgagaagacaaagggagaacagtggttttttcttcatattgttaatgttgttaatggtttggt |
14250 |
T |
|
| Q |
208 |
ttcaagatgcaattgttagagaa |
230 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
14249 |
ttcaagatgcaattgttagagaa |
14227 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University