View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9363_low_52 (Length: 228)
Name: NF9363_low_52
Description: NF9363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9363_low_52 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 20 - 213
Target Start/End: Complemental strand, 40762083 - 40761890
Alignment:
| Q |
20 |
ttttttatataaaatcgaaaagcgtataaaatgtcacaatgtctggagtcaaattctgatgtctaaaaaacatttctgatactttaattgtgaaattctg |
119 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40762083 |
ttttttatataaaatcgacaagcgtataaaatgtcacaatgtctggagtcaaattctgatgtctaaaaaacatttctgatactttaattgtgaaattctg |
40761984 |
T |
 |
| Q |
120 |
tttatgacagttgacagtggaaggtgagttttaccacaagtcatgctttaggtgtacacatggaggatgttttctcagcccttcatcctatgct |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40761983 |
tttatgacagttgacagtggaaggtgagttttaccacaagtcatgctttaggtgtacacatggaggatgttttctcagcccttcatcctatgct |
40761890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 59 - 95
Target Start/End: Complemental strand, 42583924 - 42583888
Alignment:
| Q |
59 |
tgtctggagtcaaattctgatgtctaaaaaacatttc |
95 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
42583924 |
tgtctggtgtcaaattctgatgtctaaaaaacatttc |
42583888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University