View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9363_low_58 (Length: 216)
Name: NF9363_low_58
Description: NF9363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9363_low_58 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 84; Significance: 4e-40; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 17 - 104
Target Start/End: Original strand, 6566809 - 6566896
Alignment:
| Q |
17 |
acgtattgggccatgaataaatggagagaaatgagaagggtcagagagcagcggcttattgatattatggttgaaagaagggtaagag |
104 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6566809 |
acgtattgggccatgaataaatgaagagaaatgagaagggtcagagagcagcggcttattgatattatggttgaaagaagggtaagag |
6566896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University