View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9363_low_9 (Length: 460)
Name: NF9363_low_9
Description: NF9363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9363_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 229; Significance: 1e-126; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 7 - 288
Target Start/End: Complemental strand, 34060900 - 34060620
Alignment:
| Q |
7 |
agtacaaggtgtttttcaagcacaaaattttgaaagggacnnnnnnntgaggcaatgcaataaatatggtcaagaattaagaaggggttttttcacctac |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34060900 |
agtacaaggtgtttttcaagcacaaaattttgaaagggacaaaaaaatgaggcaatgcaataaatatggtcaagaattaagaaggggttttttcacctac |
34060801 |
T |
 |
| Q |
107 |
aagagaaaatgtttgtggagatctaatgtttgttgtattaagtggggttgtgtgggacatgtggaaagaatatgcgaggtccaagtgaaaagagaagtcg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34060800 |
aagagaaaatgtttgtggagatctaatgtttggtgtattaagtggggttgtgtgggacatgtagaaagaatatgcgaggtccaagtgaaaagagaagtcg |
34060701 |
T |
 |
| Q |
207 |
atgtttcttaaaatcaatagcggcacttgagttaggttggggctagggctccgttgtttgaggaaatcattgtttgaaattg |
288 |
Q |
| |
|
|||||||||||||||||||||||| | ||||| ||||||||||| ||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
34060700 |
atgtttcttaaaatcaatagcggc-cctgagtaaggttggggcttgggctccattgtttgaggaaatcattgtttgaaattg |
34060620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 305 - 364
Target Start/End: Complemental strand, 34060592 - 34060533
Alignment:
| Q |
305 |
ggtattgcatcttcacagaagaaaaagaaattttgacttagctagttcaaaatatacaaa |
364 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
34060592 |
ggtattgcatcttcacatgagaaaaagaaattttgacttagctggttcaaaaaatacaaa |
34060533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University