View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9364_high_4 (Length: 254)
Name: NF9364_high_4
Description: NF9364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9364_high_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 244; Significance: 1e-135; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 40068444 - 40068687
Alignment:
| Q |
1 |
tgctgagaggttgatagagagaatagaggattttgttttgggtttgttgcttccactttactttgcttcaagtgggttgaaaactgatgtgactaagatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40068444 |
tgctgagaggttgatagagagaatagaggattttgttttgggtttgttgcttccactttactttgcttcaagtgggttgaaaactgatgtgactaagatt |
40068543 |
T |
 |
| Q |
101 |
agtggtggaaaagcttgggggctattggttttagtgattgcaactgcttgtgctgggaagattctggggacttttgttgttgctatgatgtgtaggatgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40068544 |
agtggtggaaaagcttgggggctattggttttagtgattgcaactgcttgtgctgggaagattctggggacttttgttgttgctatgatgtgtaggatgc |
40068643 |
T |
 |
| Q |
201 |
cagttagagagtcaattacacttggagtgctgatgaacaccaaa |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40068644 |
cagttagagagtcaattacacttggagtgctgatgaacaccaaa |
40068687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 10 - 244
Target Start/End: Original strand, 40026204 - 40026438
Alignment:
| Q |
10 |
gttgatagagagaatagaggattttgttttgggtttgttgcttccactttactttgcttcaagtgggttgaaaactgatgtgactaagattagtggtgga |
109 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||| | ||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40026204 |
gttgatagagagaattgaggattttgtaatgggtttgcttcttccactttattttgcttcgagtgggttgaaaactgatgtgactaagattagtggtgga |
40026303 |
T |
 |
| Q |
110 |
aaagcttgggggctattggttttagtgattgcaactgcttgtgctgggaagattctggggacttttgttgttgctatgatgtgtaggatgccagttagag |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||| || ||| ||||||||||||||| | |||| ||||||||||||| ||||||| ||||| |||| ||||| |
|
|
| T |
40026304 |
aaagcttgggggctattggttttagtgatttcagttgcctgtgctgggaagattatagggatttttgttgttgctttgatgtggaggattccagctagag |
40026403 |
T |
 |
| Q |
210 |
agtcaattacacttggagtgctgatgaacaccaaa |
244 |
Q |
| |
|
| ||||||||||||||||| || |||||||||||| |
|
|
| T |
40026404 |
aatcaattacacttggagtactcatgaacaccaaa |
40026438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University