View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9364_low_10 (Length: 302)
Name: NF9364_low_10
Description: NF9364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9364_low_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 17 - 292
Target Start/End: Original strand, 2341224 - 2341511
Alignment:
| Q |
17 |
atctgtcaaattgttctctcagtagtaaaatatttgcctcttgtagattgaacgtgaaggatatgttaaggaggat--------------aagaccaaac |
102 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
2341224 |
atctgtcaaattgttctc--agtagtaaaatatttgcctcttgtagatggaacgtgaaggatatgttaaggaagatgacagaatccaactaagaccaaac |
2341321 |
T |
|
| Q |
103 |
cttgtgaaccttccgttggagcaatatggaggaccaattcctgaaggcccttgggccatgcagatgtcccaagaatttctctctggtgtcttaattgaaa |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2341322 |
cttgtgaaccttccgttggagcaatatggaggaccaattcctgaaggcccttgggccttgcagatgtcccaagaatttctctctggtgtcttaattgaaa |
2341421 |
T |
|
| Q |
203 |
accctcaggccttgcatatgtcagaaattctctctggtgtctcagttgaaaaccctcgggccttgcagatgtcccaatcatttttctctg |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2341422 |
accctcaggccttgcatatgtcagaaattctctctggtgtctcagttgaaaaccctcgggccttgcagatgtcccaatcatttttctctg |
2341511 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 18 - 88
Target Start/End: Original strand, 7751367 - 7751437
Alignment:
| Q |
18 |
tctgtcaaattgttctctcagtagtaaaatatttgcctcttgtagattgaacgtgaaggatatgttaagga |
88 |
Q |
| |
|
|||||||||||||| ||| | | |||||| || ||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
7751367 |
tctgtcaaattgttttcttaattgtaaaaaatctgcttcttgtagattgaacatgatggatatgttaagga |
7751437 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University