View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9364_low_17 (Length: 231)
Name: NF9364_low_17
Description: NF9364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9364_low_17 |
 |  |
|
| [»] scaffold0021 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0021 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: scaffold0021
Description:
Target: scaffold0021; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 161427 - 161197
Alignment:
| Q |
1 |
cctctcaaacagcataacaacctaagataaagaatatatatcagcttatgaaattacaattattttaaaatagatatatcttatcacataaaatttgaag |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
161427 |
cctctcaaacaacataacaacctaagataaagaatatatatcagcttatgaaattacaattattttaaaatagatatatcttatcacataaaatttgaag |
161328 |
T |
 |
| Q |
101 |
tatacatatatcttataagttactgcgggaccttccaaatgtaagtagcttctatagagaacaattttactcgataaagtgtataaaagtgatcatatat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
161327 |
tatacatatatcttataagttactgcgggaccttccaaatgtaagtagcttctatagagaacaattttactcgataaagtgtataaaagtgatcatacat |
161228 |
T |
 |
| Q |
201 |
aacatatattttttggtggtggccggggttt |
231 |
Q |
| |
|
|||||||||||||||||||||| |||||||| |
|
|
| T |
161227 |
aacatatattttttggtggtggtcggggttt |
161197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University