View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9364_low_18 (Length: 229)
Name: NF9364_low_18
Description: NF9364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9364_low_18 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 7 - 229
Target Start/End: Complemental strand, 796505 - 796287
Alignment:
| Q |
7 |
gaaaagggaactctctaggaacctacccaaaagaaaatgcctttttattaggctggtgctagctagtagtactattgtacttactagttttgcaacacaa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
796505 |
gaaaagggaactctctaggaacctacccaaaagaaaatgcctttttattaggctggtgctagctagtagtactattgtacttactaattttgcaacacaa |
796406 |
T |
 |
| Q |
107 |
caaaattcattttggaatgtctatgtctattgcatgccatacactttgtattttgtgttattttcatgacacgtggatgcttctagtcacaccatttggc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
796405 |
caaaattcattttggaatgtctatgtctat----tgccatacactttgtatcttgtgttattttcatgacacgtggatgcttctagtcacaccatttggc |
796310 |
T |
 |
| Q |
207 |
atcttcacttgagagtgatttat |
229 |
Q |
| |
|
|||||||||||||| ||||||| |
|
|
| T |
796309 |
atcttcacttgagaccgatttat |
796287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University