View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9364_low_9 (Length: 317)
Name: NF9364_low_9
Description: NF9364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9364_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 124; Significance: 9e-64; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 124; E-Value: 9e-64
Query Start/End: Original strand, 1 - 187
Target Start/End: Complemental strand, 49257998 - 49257797
Alignment:
| Q |
1 |
ggtggtctgttttcatatttgcatcgttgcggttaatcttgtactttcctattcttgacnnnnnnnntgtgt---------------caagggaaggagg |
85 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
49257998 |
ggtggtctgttttcatatttgcatcgttgcggttaatcttgtactttcctattcttgacaaaaaaaatgtgttaaccctttggttttcaagggaaggagg |
49257899 |
T |
 |
| Q |
86 |
ccctgataacccagagttcgatcgagaggtaaataaagtttgcacaagaattattccatccaaaaattgctttgaatagttttactatggactttttcac |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49257898 |
ccctgataacccagagttcgatcgagaggtaaataaagtctgcacaagaattattccatccaaaaattgctttgaatagttttactatggactttttcac |
49257799 |
T |
 |
| Q |
186 |
ca |
187 |
Q |
| |
|
|| |
|
|
| T |
49257798 |
ca |
49257797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 197 - 298
Target Start/End: Complemental strand, 49257707 - 49257606
Alignment:
| Q |
197 |
taacatcaattttataactcttttctgtgtgaaagctttttcctccttggaccatacagtatatgagatatgatctttttaattaatcaagttggcaact |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49257707 |
taacatcaattttataactcttttctgtgtgaatgctttttcctccttggaccatacagtatatgagatatgatctttttaattaatcaagttggcaact |
49257608 |
T |
 |
| Q |
297 |
ct |
298 |
Q |
| |
|
|| |
|
|
| T |
49257607 |
ct |
49257606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 100 - 152
Target Start/End: Complemental strand, 6114455 - 6114403
Alignment:
| Q |
100 |
agttcgatcgagaggtaaataaagtttgcacaagaattattccatccaaaaat |
152 |
Q |
| |
|
||||| || ||||||||||||||||||| ||||||||||| ||| ||||||| |
|
|
| T |
6114455 |
agttcaattgagaggtaaataaagtttggtcaagaattattacattcaaaaat |
6114403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University