View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9365_high_11 (Length: 228)
Name: NF9365_high_11
Description: NF9365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9365_high_11 |
 |  |
|
| [»] chr6 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 197; Significance: 1e-107; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 7 - 228
Target Start/End: Complemental strand, 1218058 - 1217841
Alignment:
| Q |
7 |
cttatatgtataaaagattcctcgatgtgggactcgtgtccaacagctttggtagagtatttggtctttcttctccaacagacataatcttaatgcatcc |
106 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1218058 |
cttacatgtataaaagattcctcgatgtgggactcgtgtccaacagctttggtagagtatttggtctttcttctccaacagacataatcttaatgcatcc |
1217959 |
T |
 |
| Q |
107 |
ttatccttttaatttacttgtgatagagtcattctcaatttccttaattatatgattttgtggctatcctgtaagctaccattctcaatccttatatgat |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
1217958 |
ttatccttttaatttacttgtgatagagtcattctcaatttcc----ttatatgattttgtggttatcctgtaagctaccattctcaatccttatatgat |
1217863 |
T |
 |
| Q |
207 |
taaatactatatgctatatgct |
228 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
1217862 |
taaatactatatgctatatgct |
1217841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 123 - 152
Target Start/End: Complemental strand, 1248142 - 1248113
Alignment:
| Q |
123 |
cttgtgatagagtcattctcaatttcctta |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
1248142 |
cttgtgatagagtcattctcaatttcctta |
1248113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 90 - 123
Target Start/End: Complemental strand, 1248604 - 1248571
Alignment:
| Q |
90 |
ataatcttaatgcatccttatccttttaatttac |
123 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
1248604 |
ataatcttaatgtatccttatccttttaatttac |
1248571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University