View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9365_low_22 (Length: 250)
Name: NF9365_low_22
Description: NF9365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9365_low_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 240; Significance: 1e-133; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 45084253 - 45084492
Alignment:
| Q |
1 |
tatcaagtttgctaattgcttgtaaacttgtttcttttttctaagtcattttagcatatttctgattgtcaccaatcatgactgttggagctcttgtgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45084253 |
tatcaagtttgctaattgcttgtaaacttgtttcttttttctaagtcattttagcatatttctgattgtcaccaatcatgactgttggagctcttgtgtt |
45084352 |
T |
 |
| Q |
101 |
atcttggctaggtaaaagcagtagagttggctggttgtgattggattcatgttgatgttatggatggtcgctttgtcccaaatattactattggacctct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45084353 |
atcttggctaggtaaaagcagtagagttggctggttgtgattggattcatgttgatgttatggatggtcgctttgtcccaaatattactattggacctct |
45084452 |
T |
 |
| Q |
201 |
tgtggttgatgcattgcgccctgtgacagatttacctttg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45084453 |
tgtggttgatgcattgcgccctgtgacagatttacctttg |
45084492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 115 - 212
Target Start/End: Complemental strand, 35817784 - 35817687
Alignment:
| Q |
115 |
aaagcagtagagttggctggttgtgattggattcatgttgatgttatggatggtcgctttgtcccaaatattactattggacctcttgtggttgatgc |
212 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||| | | ||||||| || ||||||||| ||||| |||| |
|
|
| T |
35817784 |
aaagcagtaaagttggctggttgtgattggattcatggtgatgttatggatggtcgctttgttcaagatattacaataggacctcttctggtttatgc |
35817687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 103 - 166
Target Start/End: Original strand, 45566769 - 45566832
Alignment:
| Q |
103 |
cttggctaggtaaaagcagtagagttggctggttgtgattggattcatgttgatgttatggatg |
166 |
Q |
| |
|
|||| |||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
45566769 |
cttgcctaggtgaaagcagtagagttggctggttgtgattggattcatgatgatgttatggatg |
45566832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University