View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9365_low_24 (Length: 247)
Name: NF9365_low_24
Description: NF9365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9365_low_24 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 20 - 232
Target Start/End: Complemental strand, 40328484 - 40328275
Alignment:
| Q |
20 |
ggtatattgtagaaagaaagaaaagtaatagatgaccattctattttaggtttgtggatgtgtaactttctgagtggcacaggaaggaagtgtttgttta |
119 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40328484 |
ggtatattatagaaagaaagaaaagtaatagatgaccattctattttaggtttgtggatgtgtaactttctgagtggcacaggaaggaagtgtttgttta |
40328385 |
T |
 |
| Q |
120 |
agggattgtgacaaagccaattcaatactagtgccnnnnnnnnnnnnnattacgtttgattaattacttttgatttcaagctgttgtgtgttgttccatt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40328384 |
agggattgtgacaaagccaattcaatactagtgc---tttttttttttattacgtttgattaattacttttgatttcaagctgttgtgtgttgttccatt |
40328288 |
T |
 |
| Q |
220 |
ttcttaacctatg |
232 |
Q |
| |
|
||||||||||||| |
|
|
| T |
40328287 |
ttcttaacctatg |
40328275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University