View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9365_low_26 (Length: 241)
Name: NF9365_low_26
Description: NF9365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9365_low_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 45084223 - 45083996
Alignment:
| Q |
1 |
tttgcaaagttggcagaaagaatagatggagaaacaatgatatcgctttttgaaaacttgtcaacacgagatgaagccttaaccacagttgaaattttcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45084223 |
tttgcaaagttggcagaaagaatagatggagaaacaatgatatcgctttttgaaaacttgtcaacacgagatgaagccttaaccacagttgaaattttcc |
45084124 |
T |
 |
| Q |
101 |
tcctgagttcacaataacaaaaagatattaaagcaggctgcattatgctttcaaatacagcaagccttctctaacaaattc----gggtgtgtgtgtgga |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| | ||||||||||| | |
|
|
| T |
45084123 |
tcctgagttcacaataacaaaaagatattaaagcaggctgcattatgctttcaaataccgcaagccttctctaacaaattccggagtgtgtgtgtgtgca |
45084024 |
T |
 |
| Q |
197 |
atg-aaaatgtattgtgtatagttcttt |
223 |
Q |
| |
|
||| |||||||||||||||||||||||| |
|
|
| T |
45084023 |
atgaaaaatgtattgtgtatagttcttt |
45083996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University