View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9365_low_35 (Length: 216)

Name: NF9365_low_35
Description: NF9365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9365_low_35
NF9365_low_35
[»] chr3 (1 HSPs)
chr3 (108-146)||(8521930-8521968)


Alignment Details
Target: chr3 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 108 - 146
Target Start/End: Original strand, 8521930 - 8521968
Alignment:
108 ctaactaatcatgtaaatatcacacttaccatgtctatt 146  Q
    |||||||||||||||||||||||||||| ||||||||||    
8521930 ctaactaatcatgtaaatatcacacttatcatgtctatt 8521968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University