View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9365_low_36 (Length: 216)
Name: NF9365_low_36
Description: NF9365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9365_low_36 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 108 - 146
Target Start/End: Original strand, 8521930 - 8521968
Alignment:
| Q |
108 |
ctaactaatcatgtaaatatcacacttaccatgtctatt |
146 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
8521930 |
ctaactaatcatgtaaatatcacacttatcatgtctatt |
8521968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University