View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9365_low_37 (Length: 215)
Name: NF9365_low_37
Description: NF9365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9365_low_37 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 1 - 204
Target Start/End: Complemental strand, 3430160 - 3429957
Alignment:
| Q |
1 |
tttcttctccttcactttttccttcctctccaaacatttactctaatgaggttagttaattacacttaactctactaattcatgttatcatcattgttaa |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3430160 |
tttcttctccttcactctttccttcctctccaaacatttactctaatgaggttagttaattacagttaactctactaattcatgctatcatcattgttaa |
3430061 |
T |
|
| Q |
101 |
tttattattattacttttttcaactaattcatacatatgtctagtagtttgagatcaatattgagtcttacaaattgtttcgacttgtggcgtgagaatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||| ||||||| |||||||||| |
|
|
| T |
3430060 |
tttattattattacttttttcaactaattcatgcatatgtctagtagtttgagatcaatattgagtcttagaaattgtttccacttgtgacgtgagaatt |
3429961 |
T |
|
| Q |
201 |
atct |
204 |
Q |
| |
|
|||| |
|
|
| T |
3429960 |
atct |
3429957 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University