View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9366_high_101 (Length: 215)
Name: NF9366_high_101
Description: NF9366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9366_high_101 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 43987197 - 43987401
Alignment:
| Q |
1 |
atgaattcaaagggattcgagtatgatctaatcacctactcttcaatactcgaggcagttggtaaggttgatgaagttcgtaatatggcagagtcgtgaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43987197 |
atgaattcaaagggattcgagtatgatctaatcacctactcttcaatactcgaggcagttggtaaggttgatgaagatcgtaatatggcagagtcgtgaa |
43987296 |
T |
 |
| Q |
101 |
aaccaccttgtattaccttttttagtaaccgtgcaatgcgtataaatcaatggaaaatgcttattgttactagagaaatctgacaagaaacttaagaatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43987297 |
aaccaccttgtattaccttttttagtaaccgtgcaatgcgtataaatcaatggaaaatgcttattgttactagagaaatctgacaagaaacttaagaatc |
43987396 |
T |
 |
| Q |
201 |
ctatg |
205 |
Q |
| |
|
||||| |
|
|
| T |
43987397 |
ctatg |
43987401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 152 - 205
Target Start/End: Complemental strand, 15517130 - 15517077
Alignment:
| Q |
152 |
ggaaaatgcttattgttactagagaaatctgacaagaaacttaagaatcctatg |
205 |
Q |
| |
|
|||||||||||||||||| |||||||| ||||||||||| ||||||| |||| |
|
|
| T |
15517130 |
ggaaaatgcttattgttatgagagaaatttgacaagaaacacaagaatcttatg |
15517077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 201
Target Start/End: Complemental strand, 36744566 - 36744522
Alignment:
| Q |
157 |
atgcttattgttactagagaaatctgacaagaaacttaagaatcc |
201 |
Q |
| |
|
|||||||||||||| |||||| | ||||||||||||||||||||| |
|
|
| T |
36744566 |
atgcttattgttacgagagaagtttgacaagaaacttaagaatcc |
36744522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University