View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9366_high_103 (Length: 207)
Name: NF9366_high_103
Description: NF9366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9366_high_103 |
 | |
|
| [»] scaffold0002 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0002 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 18 - 194
Target Start/End: Original strand, 437732 - 437908
Alignment:
| Q |
18 |
tgttgttcatcgctgtcaatctaaatccattcacatactcatcatctaactccttctgcttctcactatcctctacaatagatagtatcccttgtgcttc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||| |
|
|
| T |
437732 |
tgttgttcatcgctgtcaatctaaatccattcacatactcatcatctaactccttctgcttctcactatccattacaatagatagtatcccttgtggttc |
437831 |
T |
|
| Q |
118 |
agcatgacttgaggcgtctactatttcagcattatcaaacaggagcatccgaacaactgataattgggttcctatgc |
194 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
437832 |
agcatgacttgaggtgtctactatttcagcattatcaaacaggagcatccgaaccactgataattgggttcctatgc |
437908 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 18 - 191
Target Start/End: Complemental strand, 28609172 - 28608999
Alignment:
| Q |
18 |
tgttgttcatcgctgtcaatctaaatccattcacatactcatcatctaactccttctgcttctcactatcctctacaatagatagtatcccttgtgcttc |
117 |
Q |
| |
|
|||||||||||| |||||||||||||||||| ||||||||||||||||| ||||| ||||||||||||||| ||||||||||| ||| || ||||| |
|
|
| T |
28609172 |
tgttgttcatcgttgtcaatctaaatccattaacatactcatcatctaattccttttgcttctcactatccattacaatagataatatgccccttgcttt |
28609073 |
T |
|
| Q |
118 |
agcatgacttgaggcgtctactatttcagcattatcaaacaggagcatccgaacaactgataattgggttccta |
191 |
Q |
| |
|
| ||||||||| || ||| |||||| |||| ||| ||||||||||||||||||| ||| | ||||||||||| |
|
|
| T |
28609072 |
atcatgacttgtggtgtccactattgcagctttaccaaacaggagcatccgaaccactagaagttgggttccta |
28608999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University