View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9366_high_26 (Length: 397)
Name: NF9366_high_26
Description: NF9366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9366_high_26 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 356; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 356; E-Value: 0
Query Start/End: Original strand, 19 - 386
Target Start/End: Original strand, 43986859 - 43987226
Alignment:
| Q |
19 |
aagctatgggtcttttcaatgagatgaaaaaacttggattcatccccgatgtttatgcttataatgcgctcataactgggatggtaagggcagacatgat |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43986859 |
aagctatgggtcttttcaatgagatgaaaaaacttggatgcatccccgatgtttatgcttataatgcgctcataactgggatggtaagggcagacatgat |
43986958 |
T |
 |
| Q |
119 |
ggacgaagctttttctttgtttcgaactatggaagaaaatggttgcaacccggatataaactcacataacatcatactaaatggcttggctaggaccggt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43986959 |
ggacgaagctttttctttgtttcgaactatggaagaaaatggttgcaacccagatataaactcacataacatcatactaaatggcttggctaggaccggt |
43987058 |
T |
 |
| Q |
219 |
ggcccgaagcgtgctatggaaatgttcgcgaaaatgaagagttctactatcaagccggatgcggtttcttacaacacagttcttggctgccttagtcgtg |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43987059 |
ggcccgaagcgtgctatggaaatgttcgcgaaaatgaagagttctactatcaagccggatgcggtttcttacaacacagttcttggctgccttagtcgtg |
43987158 |
T |
 |
| Q |
319 |
caggactatttgaagaggctactaagcttatgaaggaaatgaattcaaagggattcgagtataatcta |
386 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
43987159 |
caggactatttgaagaggctactaagcttatgaaggaaatgaattcaaagggattcgagtatgatcta |
43987226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University