View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9366_high_48 (Length: 303)
Name: NF9366_high_48
Description: NF9366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9366_high_48 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 16 - 294
Target Start/End: Complemental strand, 2792572 - 2792295
Alignment:
| Q |
16 |
acataattcactcactaactctttcttctcacattattcatctttgcacatttttctttgtctaaactttcttattcaagnnnnnnntgggaaggcctcc |
115 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
2792572 |
acataattcattcactaactctttcttctcacattattcatctttgcacatttttctttgtctaaactttctcattcaagaaaaaaatgggaaggcctcc |
2792473 |
T |
 |
| Q |
116 |
ttgttgtgataagaccaatgtgaaaagaggtttatggactcctgaggaagatgctaaaatacttgcttatgtagccaatcatggaattggaaattggaca |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2792472 |
ttgttgtgataagaccaatgtgaaaagaggtttatggactcctgaggaagatgctaaaatacttgcttatgtagccaatcatggaattggaaattggaca |
2792373 |
T |
 |
| Q |
216 |
gctgttccaaagaaagcaggnnnnnnncgttaattcctttattcacgaacatggttttaaattgcagttgcagtataat |
294 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2792372 |
gctgttccaaagaaagcagg-ttttttcgttaattcctttattcacgaacatggttttaaattgcagttgcagtataat |
2792295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University