View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9366_high_69 (Length: 252)
Name: NF9366_high_69
Description: NF9366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9366_high_69 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 8 - 232
Target Start/End: Complemental strand, 32781753 - 32781529
Alignment:
| Q |
8 |
tggaggttgtgatgagtattgctataaacctgattattggtgcaggtgaatactacaaattgtgatactgtgataacaggacttcaatttggtctattgg |
107 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32781753 |
tggaggttgtgatgaatattgctataaacctgattattggtgcaggtgaatactacaaattgtgatactgtgataacaggacttcaatttggtctattgg |
32781654 |
T |
|
| Q |
108 |
gatgtctgagtactgtttcaacatttgttgctgaattgtatgaaatgatagaaaacaagcatctttggagagcatttgtctatgctatggttaccatttg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32781653 |
gatgtctgagtactgtttcaacatttgttgctgaattgtatgaaatgatagaaaacaagcatctttggagagcatttgtctatgctatggttaccatttg |
32781554 |
T |
|
| Q |
208 |
tgtttcattttcttttgggatctta |
232 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
32781553 |
tgtttcattttcttttgggatctta |
32781529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University