View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9366_high_71 (Length: 251)
Name: NF9366_high_71
Description: NF9366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9366_high_71 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 6 - 235
Target Start/End: Original strand, 16559159 - 16559388
Alignment:
| Q |
6 |
tttggtgtttaattttaattagaagatctacttttcactgttcgtgtaaacaacagctggtttactgcagtgcattgtaacttcattggcattgtgtatt |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
16559159 |
tttggtgtttaattttaattagaagatctactattcactgttcgtgtaaacaacagctcgtttactgcagtgcattgtaacttcactggcattgtgtatt |
16559258 |
T |
 |
| Q |
106 |
tgtgttgagaacttctccaaatttgttagggtgcaagcagttgggaaatcaagtgtgagcgattatgtcacacattaattaggaatggagaggggactga |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||| || |
|
|
| T |
16559259 |
tgtgttgagaacttctccaaatttgttagggtgcaagcagttgggaaatcaagtgtgagcgattatgttacacatcgattaggaatggagaggggaccga |
16559358 |
T |
 |
| Q |
206 |
tatacctattgccttaagattttggttgga |
235 |
Q |
| |
|
|||| ||||| ||||||||||||| |||| |
|
|
| T |
16559359 |
tatatctattatcttaagattttggatgga |
16559388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 193 - 230
Target Start/End: Original strand, 51681598 - 51681635
Alignment:
| Q |
193 |
gagaggggactgatatacctattgccttaagattttgg |
230 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
51681598 |
gagaggggactcatatacccattgccttaagattttgg |
51681635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000005; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 152 - 195
Target Start/End: Complemental strand, 5981893 - 5981850
Alignment:
| Q |
152 |
aatcaagtgtgagcgattatgtcacacattaattaggaatggag |
195 |
Q |
| |
|
||||||||||||| ||||||||| ||||| |||||||||||||| |
|
|
| T |
5981893 |
aatcaagtgtgagggattatgtcccacatcaattaggaatggag |
5981850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 145 - 195
Target Start/End: Complemental strand, 12156825 - 12156775
Alignment:
| Q |
145 |
gttgggaaatcaagtgtgagcgattatgtcacacattaattaggaatggag |
195 |
Q |
| |
|
|||||| ||||||||||||| ||||||||| ||||| ||||||||||||| |
|
|
| T |
12156825 |
gttgggtaatcaagtgtgagtgattatgtcccacatcgattaggaatggag |
12156775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 145 - 195
Target Start/End: Original strand, 15327847 - 15327897
Alignment:
| Q |
145 |
gttgggaaatcaagtgtgagcgattatgtcacacattaattaggaatggag |
195 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||| | ||||||||||| |
|
|
| T |
15327847 |
gttgggaaatcaagtgtgagtgattatgtctcacatcgactaggaatggag |
15327897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University