View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9366_high_72 (Length: 251)
Name: NF9366_high_72
Description: NF9366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9366_high_72 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 57; Significance: 7e-24; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 86 - 160
Target Start/End: Complemental strand, 53350495 - 53350424
Alignment:
| Q |
86 |
aattactcaaatttgaaaaattattgttcacatattgtatatttttcagcccctccaagaaaaaagttcctagct |
160 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
53350495 |
aattactcaaatttgaaaaatt---gttcacatattgtatatttttcagcccctccaaggaaaaagttcctagct |
53350424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 159 - 240
Target Start/End: Complemental strand, 53350372 - 53350291
Alignment:
| Q |
159 |
ctttcatgttcttagcttttgccattgttctctttgaactcttgtttttgttttgagtccttgccctgctcattgtgtctgt |
240 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||||||||||||| |||||||||||| | | |||||| |||||||||| |
|
|
| T |
53350372 |
ctttcatgttcttgcattttgctattgttctctttgaactcttgtttctgttttgagtccctcctctgctcgttgtgtctgt |
53350291 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 65
Target Start/End: Complemental strand, 53350652 - 53350590
Alignment:
| Q |
1 |
ttatccttctaacatttgtttggaggtaactatatataggacagaatatgacaaaactgatgtat |
65 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||| |||||||| | ||||||||||||||||| |
|
|
| T |
53350652 |
ttatccttctaacattattttggaggtaac--tatacaggacagagtgtgacaaaactgatgtat |
53350590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University