View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9366_high_79 (Length: 242)
Name: NF9366_high_79
Description: NF9366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9366_high_79 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 12 - 226
Target Start/End: Complemental strand, 18416024 - 18415804
Alignment:
| Q |
12 |
tgtttaatagattgtcagtcccaaacgattatataagatgagtatacagaagggaagnnnnnnnnn------ttcctactagtcaaacaatattgtttgc |
105 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||| |||| |||| ||||||||| |||||||||||||| ||| |
|
|
| T |
18416024 |
tgtttaattgattgtcagtcccaaacgattatataagatgagtatatagaatggaaaaaaaaaaaaaaaaaattcctactaatcaaacaatattgtctgc |
18415925 |
T |
|
| Q |
106 |
ggcgtttagccttgctccattaattacgtgggttgtatgtttgtttttcctcattgagggggtgtgtgacgctccacattcagctgacaacttttctttt |
205 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18415924 |
ggtgtttagccttgctccattaattacgtgggttgtatgtttgtttttcctcattgagggggtgtgtgacgctccacattcagctgacaacttttctttt |
18415825 |
T |
|
| Q |
206 |
tgtggcataatttgttgacaa |
226 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
18415824 |
tgtggcataatttgttgacaa |
18415804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University