View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9366_high_85 (Length: 240)
Name: NF9366_high_85
Description: NF9366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9366_high_85 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 2 - 208
Target Start/End: Complemental strand, 29305664 - 29305463
Alignment:
| Q |
2 |
attgacatccacacacggtatggtatattagattatgattcgctattgtcacggcacgtttttacacaatcaacacaatgatggttgttggatgatggtc |
101 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||||||| ||||| |||||||| || ||||||||||| ||||| ||||||||| ||| |
|
|
| T |
29305664 |
attgacatccacacacggtat-----attagattatgattcactattgtctcggcaagtttttacgcagtcaacacaatggtggtttttggatgatagtc |
29305570 |
T |
 |
| Q |
102 |
taaattttaacgtagattttgatgttttaaatatatnnnnnnnnctaaatttgaaatctagattgttcaattttagtcaacggttattgtcgatatattg |
201 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
29305569 |
taaattttaacgtaaattatgatgttttaaatataaaaaaaaaattaaatttgaaatctagattgttcaattttagtcaacggttattgtcgatatactg |
29305470 |
T |
 |
| Q |
202 |
attgcat |
208 |
Q |
| |
|
||||||| |
|
|
| T |
29305469 |
attgcat |
29305463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University