View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9366_low_103 (Length: 302)
Name: NF9366_low_103
Description: NF9366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9366_low_103 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 92; Significance: 1e-44; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 190 - 285
Target Start/End: Complemental strand, 26953980 - 26953885
Alignment:
| Q |
190 |
aataatacttcctataatttccatctctcacgagcaggtcctgccacggttgtttgtgattacatgaccttaacgttcatgtttctgtcagttgtt |
285 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26953980 |
aataatacttcatataatttccatctctcacgagcaggtcctgccacggttgtttgtgattacatgaccttaacgttcatgtttctgtcagttgtt |
26953885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 1 - 95
Target Start/End: Complemental strand, 26954172 - 26954078
Alignment:
| Q |
1 |
gttttttaaaattattagcagtgtttgtgtgttggtaatagtatcgacgttaatgatgtgttggatgtatatatctttgctttcgcagattgcaa |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
26954172 |
gttttttaaaattattagcagtgtttgtgtgttggtaatagtatcgacgttaatgatgtgtcggatgtatatatctttgctttcgcagattgcaa |
26954078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University