View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9366_low_104 (Length: 302)

Name: NF9366_low_104
Description: NF9366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9366_low_104
NF9366_low_104
[»] chr4 (2 HSPs)
chr4 (190-285)||(26953885-26953980)
chr4 (1-95)||(26954078-26954172)


Alignment Details
Target: chr4 (Bit Score: 92; Significance: 1e-44; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 190 - 285
Target Start/End: Complemental strand, 26953980 - 26953885
Alignment:
190 aataatacttcctataatttccatctctcacgagcaggtcctgccacggttgtttgtgattacatgaccttaacgttcatgtttctgtcagttgtt 285  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26953980 aataatacttcatataatttccatctctcacgagcaggtcctgccacggttgtttgtgattacatgaccttaacgttcatgtttctgtcagttgtt 26953885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 1 - 95
Target Start/End: Complemental strand, 26954172 - 26954078
Alignment:
1 gttttttaaaattattagcagtgtttgtgtgttggtaatagtatcgacgttaatgatgtgttggatgtatatatctttgctttcgcagattgcaa 95  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
26954172 gttttttaaaattattagcagtgtttgtgtgttggtaatagtatcgacgttaatgatgtgtcggatgtatatatctttgctttcgcagattgcaa 26954078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University