View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9366_low_124 (Length: 287)
Name: NF9366_low_124
Description: NF9366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9366_low_124 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 161; Significance: 7e-86; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 161; E-Value: 7e-86
Query Start/End: Original strand, 1 - 169
Target Start/End: Complemental strand, 53756111 - 53755943
Alignment:
| Q |
1 |
ttgcttctatgtgttgctccttctttgtttcacattacttcagctgaagatccctataaattcttcaactggaatgttacttacggtgacatttacccac |
100 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53756111 |
ttgcttctatgtgtttctacttctttgtttcacattacttcagctgaagatccctataaattcttcaactggaatgttacttacggtgacatttacccac |
53756012 |
T |
 |
| Q |
101 |
ttggagttcgtcaaagggtacgtgtgtttcaaatcaaatctcaatctcactcactttctcatgcttttg |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53756011 |
ttggagttcgtcaaagggtacgtgtgtttcaaatcaaatctcaatctcactcactttctcatgcttttg |
53755943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 244 - 287
Target Start/End: Complemental strand, 53755867 - 53755824
Alignment:
| Q |
244 |
cagggtatattgatcaatggccaattccctggtccagacattca |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53755867 |
cagggtatattgatcaatggccaattccctggtccagacattca |
53755824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 43 - 110
Target Start/End: Complemental strand, 8572938 - 8572871
Alignment:
| Q |
43 |
gctgaagatccctataaattcttcaactggaatgttacttacggtgacatttacccacttggagttcg |
110 |
Q |
| |
|
||||||||||| || | |||||||||||||| ||||| || ||||||||||| |||||||| ||||| |
|
|
| T |
8572938 |
gctgaagatccatacaggttcttcaactggaacgttacctatggtgacatttatccacttggtgttcg |
8572871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 43 - 100
Target Start/End: Complemental strand, 44037474 - 44037417
Alignment:
| Q |
43 |
gctgaagatccctataaattcttcaactggaatgttacttacggtgacatttacccac |
100 |
Q |
| |
|
||||||||||| |||| ||||||| |||||| | ||||||| ||||||||||| |||| |
|
|
| T |
44037474 |
gctgaagatccttatagattcttcgactggacttttacttatggtgacatttatccac |
44037417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University