View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9366_low_131 (Length: 269)
Name: NF9366_low_131
Description: NF9366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9366_low_131 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 72; Significance: 8e-33; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 174 - 253
Target Start/End: Original strand, 38903437 - 38903515
Alignment:
| Q |
174 |
gacgtagtgcatgatttttatgccaatttttggatcattttcatgatggtcatatgattattgtctatgatgatatcttg |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
38903437 |
gacgtagtgcatgatttttatgccaatttttggatcattttcat-atggtcatatgattattgtctatgatgatatcttg |
38903515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 6 - 50
Target Start/End: Original strand, 38903269 - 38903313
Alignment:
| Q |
6 |
tgttatatcaccacccatattctgagtcctttcttcataatcaca |
50 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38903269 |
tgttatatcaccacccatattctgagtcctttcttcataatcaca |
38903313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000006; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 6 - 37
Target Start/End: Original strand, 33031908 - 33031939
Alignment:
| Q |
6 |
tgttatatcaccacccatattctgagtccttt |
37 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
33031908 |
tgttatatcaccacccatattctgagtccttt |
33031939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 6 - 38
Target Start/End: Original strand, 33050460 - 33050492
Alignment:
| Q |
6 |
tgttatatcaccacccatattctgagtcctttc |
38 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
33050460 |
tgttatatcaccacccatattctgagtcttttc |
33050492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 6 - 34
Target Start/End: Original strand, 43521258 - 43521286
Alignment:
| Q |
6 |
tgttatatcaccacccatattctgagtcc |
34 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
43521258 |
tgttatatcaccacccatattctgagtcc |
43521286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University