View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9366_low_133 (Length: 266)
Name: NF9366_low_133
Description: NF9366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9366_low_133 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 7 - 144
Target Start/End: Complemental strand, 814185 - 814047
Alignment:
| Q |
7 |
tatggaggttagttcaaagaattcgtggattgcttgtgatggagtgaaaagtaacattcttattatgagacaaaccattgtga-gatactttgatagata |
105 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
814185 |
tatggaggttagttcaaagaattcgtcgattgcttgtgatggagtgaaaagtaacattcttattatgtgacaaaccattgtgaggatactttgatagata |
814086 |
T |
 |
| Q |
106 |
atggttgtaatttatctcttggttgattatttatgaatt |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
814085 |
atggttgtaatttatctcttggttgattatttatgaatt |
814047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 201 - 252
Target Start/End: Complemental strand, 812402 - 812351
Alignment:
| Q |
201 |
acttatatgtatttacgggattgcgattttgaaatttcttacacgtggaaac |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
812402 |
acttatatgtatttacgggattgcgattttgaaatttcttacacgtggaaac |
812351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University