View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9366_low_134 (Length: 266)

Name: NF9366_low_134
Description: NF9366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9366_low_134
NF9366_low_134
[»] chr7 (2 HSPs)
chr7 (7-144)||(814047-814185)
chr7 (201-252)||(812351-812402)


Alignment Details
Target: chr7 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 7 - 144
Target Start/End: Complemental strand, 814185 - 814047
Alignment:
7 tatggaggttagttcaaagaattcgtggattgcttgtgatggagtgaaaagtaacattcttattatgagacaaaccattgtga-gatactttgatagata 105  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||    
814185 tatggaggttagttcaaagaattcgtcgattgcttgtgatggagtgaaaagtaacattcttattatgtgacaaaccattgtgaggatactttgatagata 814086  T
106 atggttgtaatttatctcttggttgattatttatgaatt 144  Q
    |||||||||||||||||||||||||||||||||||||||    
814085 atggttgtaatttatctcttggttgattatttatgaatt 814047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 201 - 252
Target Start/End: Complemental strand, 812402 - 812351
Alignment:
201 acttatatgtatttacgggattgcgattttgaaatttcttacacgtggaaac 252  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
812402 acttatatgtatttacgggattgcgattttgaaatttcttacacgtggaaac 812351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University