View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9366_low_145 (Length: 253)
Name: NF9366_low_145
Description: NF9366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9366_low_145 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 21 - 247
Target Start/End: Original strand, 42664498 - 42664720
Alignment:
| Q |
21 |
atcggtactatcatcgggatgtatatacttcatgagaattgttgcaaaatgaactcgagttaattagatggttttctactatgcaaaatactgacacatg |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||| ||||||||||||||| | |
|
|
| T |
42664498 |
atcggtactatcatcgggatgtatatacttcatgagaattgttgcaaaatgaactcgagtta----gatggttttcgactatacaaaatactgacacagg |
42664593 |
T |
 |
| Q |
121 |
aatagttgatcaaggatggaaatatcggagaatgaaactttgaagtgcaatattgatgcaacttttgtccatcaacataacaattttgattcaggaatgt |
220 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
42664594 |
aatagttgatcaagaatggaaaaatcggagaatgaaactttgaagtgcaatattgatgcaacttttgtccatcaacataacaattttgatacaggaatgt |
42664693 |
T |
 |
| Q |
221 |
gtatcgatatcgaaagagaataatcta |
247 |
Q |
| |
|
||||| |||||||||||||| |||||| |
|
|
| T |
42664694 |
gtatccatatcgaaagagaagaatcta |
42664720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University