View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9366_low_161 (Length: 249)
Name: NF9366_low_161
Description: NF9366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9366_low_161 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 10 - 249
Target Start/End: Complemental strand, 29506049 - 29505810
Alignment:
| Q |
10 |
gtgtttcaaaaagtgtacaaaactgtcatttgaagattaccatgagtccttctttcaaggccaatgttctagccatgttaactgcatcttcactgctaac |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29506049 |
gtgtttcaaaaagtgtacaaaactgtcatttgaagattaccatgagtccttctttcaaggccaatgttctagccatgttaactgcatcttcactgctaac |
29505950 |
T |
|
| Q |
110 |
ctacaacaacataagtttgtggcagttaggataaacacaaggctttcaagctgaatctctatgtcgcaaaacgtaatacatatacatgtacttacttcta |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
29505949 |
ctacaacaacataagtttgtggcagttaggataaacacaaggctttcaagctgaatctctatgtcgcaaaacgtaatacatatacatatacttacttcta |
29505850 |
T |
|
| Q |
210 |
ggactttttccatcacatccatgtccaatatgtctggttt |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29505849 |
ggactttttccatcacatccatgtccaatatgtctggttt |
29505810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University