View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9366_low_167 (Length: 242)
Name: NF9366_low_167
Description: NF9366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9366_low_167 |
 |  |
|
| [»] scaffold0022 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0022 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: scaffold0022
Description:
Target: scaffold0022; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 11 - 227
Target Start/End: Complemental strand, 91272 - 91056
Alignment:
| Q |
11 |
cagagagattcttgaaaagtgaaattaatattaaaggacatgattttcagttgataccttttggtgctggtagaaggggttgtcctggaataagttttgc |
110 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
91272 |
cagagagattcttgaaaagtgaaattgatattaaaggacatgattttcagttgataccttttggtgctggtagaaggggttgtcctggaataagttttgc |
91173 |
T |
 |
| Q |
111 |
tatggttgttaatgagttggttttagctaatcttgttcatcaatttgattggtcattgcctagtggagtggagagggatcaaagtttggacatggctgaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
91172 |
tatggttgttaatgagttggttttagctaatcttgttcatcaatttgattggtcattgcctagtggagtggagagggatcaaagtttggacatggctgaa |
91073 |
T |
 |
| Q |
211 |
actactgggttaactat |
227 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
91072 |
actactgggttaactat |
91056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000001; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 13 - 162
Target Start/End: Complemental strand, 43307845 - 43307696
Alignment:
| Q |
13 |
gagagattcttgaaaagtgaaattaatattaaaggacatgattttcagttgataccttttggtgctggtagaaggggttgtcctggaataagttttgcta |
112 |
Q |
| |
|
|||||||||||||| ||| ||| |||||||||| ||||||| || ||||| || ||||| || || ||||||||||||||||| ||| || ||||| |
|
|
| T |
43307845 |
gagagattcttgaatagttcaatagatattaaagggaatgatttccatttgattccatttggagcagggagaaggggttgtcctgggatagtttatgcta |
43307746 |
T |
 |
| Q |
113 |
tggttgttaatgagttggttttagctaatcttgttcatcaatttgattgg |
162 |
Q |
| |
|
|||||| ||||| | || ||||| || ||||| ||||||||| ||||| |
|
|
| T |
43307745 |
tggttgccaatgaacttgtgttagccaaccttgtacatcaatttaattgg |
43307696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 121 - 171
Target Start/End: Original strand, 35678446 - 35678496
Alignment:
| Q |
121 |
aatgagttggttttagctaatcttgttcatcaatttgattggtcattgcct |
171 |
Q |
| |
|
||||| ||||||||||| || ||||||||||||||||||||| ||||||| |
|
|
| T |
35678446 |
aatgaattggttttagcgaaccttgttcatcaatttgattggaaattgcct |
35678496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 43 - 87
Target Start/End: Complemental strand, 7415351 - 7415307
Alignment:
| Q |
43 |
aaaggacatgattttcagttgataccttttggtgctggtagaagg |
87 |
Q |
| |
|
||||||||||||||| ||||| |||| |||||||||||||||||| |
|
|
| T |
7415351 |
aaaggacatgattttgagttgttaccatttggtgctggtagaagg |
7415307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 45 - 99
Target Start/End: Original strand, 38263104 - 38263158
Alignment:
| Q |
45 |
aggacatgattttcagttgataccttttggtgctggtagaaggggttgtcctgga |
99 |
Q |
| |
|
||||| |||||||||| | ||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
38263104 |
aggacgtgattttcagctcataccatttgggtctggtagaaggggttgtcctgga |
38263158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University