View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9366_low_199 (Length: 231)
Name: NF9366_low_199
Description: NF9366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9366_low_199 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 164; Significance: 8e-88; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 14 - 213
Target Start/End: Complemental strand, 5040173 - 5039973
Alignment:
| Q |
14 |
ttattctctaagtttgctttcgttcaattgattttgtttgaatcgaggaaatttctccttgtattatttatatcgacgcaatcgattattggcttttaaa |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5040173 |
ttattctctaagtttgctttcgttcaattgattttgtttgaatcgaggaaatttctctttgtattatttatatcgacgcaatcgattattggcttttaaa |
5040074 |
T |
 |
| Q |
114 |
tgaaatcgtttctttat-nnnnnnnttatatgaaaactaatgaaataattgagtaagattgatgggcaagtgttcaaatgaaactggcccaagtcgtttt |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
5040073 |
tgaaatcgtttctttataaaaaaaattatatgaaaactaatgaaataattgagtaagattgataggcaagtgttcaaatgaaactggcccaagtcgtttt |
5039974 |
T |
 |
| Q |
213 |
c |
213 |
Q |
| |
|
| |
|
|
| T |
5039973 |
c |
5039973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 21 - 78
Target Start/End: Complemental strand, 5538402 - 5538344
Alignment:
| Q |
21 |
ctaagtttgctttcgtt-caattgattttgtttgaatcgaggaaatttctccttgtatt |
78 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||| || ||||||| ||||||||||||| |
|
|
| T |
5538402 |
ctaagtttgctttagtttcaattgattttgtttggattgaggaaaattctccttgtatt |
5538344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University