View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9366_low_203 (Length: 228)
Name: NF9366_low_203
Description: NF9366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9366_low_203 |
 | |
|
| [»] scaffold0004 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 18 - 210
Target Start/End: Original strand, 1615757 - 1615949
Alignment:
| Q |
18 |
cgtggttacaaattacaattgatatcaacaacatgctcttggttttagaggttcttctaccaaagataatttggtttgaagagtattcgctatcttgtaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1615757 |
cgtggttacaaattacaattgatatcaacaagatgctcttggttttagaggttcttctataaaagataatttggtttgaagagtattcgctatcttgtaa |
1615856 |
T |
|
| Q |
118 |
atataacaagcttatcctgtttttaattagtgaaaattttgatggacttttctttgggaattagacgtagaccatgttgttttaggccgaatc |
210 |
Q |
| |
|
|| | ||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
1615857 |
atgttacaagcttatcctgtttttaattagtgaaaattttgatggatttttctttgggaactagacgtagaccatgttgttttaggccgaatc |
1615949 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0004 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0004
Description:
Target: scaffold0004; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 53 - 139
Target Start/End: Complemental strand, 353878 - 353792
Alignment:
| Q |
53 |
ctcttggttttagaggttcttctaccaaagataatttggtttgaagagtattcgctatcttgtaaatataacaagcttatcctgttt |
139 |
Q |
| |
|
||||||| |||||||| |||||||| || ||| ||| ||||| ||||| ||||||||||||||| | || |||||||||||||| |
|
|
| T |
353878 |
ctcttgggtttagaggctcttctacaaaggattgttttgtttggagagtgctcgctatcttgtaaaggttactagcttatcctgttt |
353792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University