View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9366_low_224 (Length: 206)
Name: NF9366_low_224
Description: NF9366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9366_low_224 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 8 - 193
Target Start/End: Complemental strand, 36331682 - 36331497
Alignment:
| Q |
8 |
gagaagcagagaaagatcaaagcttattgttgtcaaagtaataatatctaatataatctaaagttgtaggctgtgacagaaagagggtccagtctttttc |
107 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36331682 |
gagaagcaaagaaagatcaaagcttattgttgtcaaagtaataatatctaatataatctaaagttgtaggctgtgacagaaagagggtccagtctttttc |
36331583 |
T |
 |
| Q |
108 |
ttcagatatgatcctctttgcaactttctatcttttataaggggggtgtctatatcaatttcttttctccttctctatgaagaaac |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36331582 |
ttcagatatgatcctctttgcaactttctatcttttataaggggggtgtctatatcaatttcttttctccttctctatgaagaaac |
36331497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University