View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9366_low_56 (Length: 392)
Name: NF9366_low_56
Description: NF9366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9366_low_56 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 173; Significance: 6e-93; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 173; E-Value: 6e-93
Query Start/End: Original strand, 197 - 385
Target Start/End: Original strand, 18352278 - 18352466
Alignment:
| Q |
197 |
gctaatatgttgtgtttactataatcattgtgccgattgaattctcttattgttatcagatgtaattgggagttcctctaaacttgaatatcacaaagtg |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
18352278 |
gctaatatgttgtgtttactataatcattgtgccgattgaattctcttattgttatcagatataactgggagttcctctaaacctgaatatcacaaagtg |
18352377 |
T |
 |
| Q |
297 |
gatatggacttggaaggtcaacaatacaatactggaaatgataaaaagtcaatcttttccatttttgctttctttatatgtctctgctt |
385 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
18352378 |
gatatggacttggaaggtcaacaatacaatactggaaatgataaaaagtcaatcttttccatttttgctttctttatatgtctttgctt |
18352466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 116; E-Value: 7e-59
Query Start/End: Original strand, 18 - 141
Target Start/End: Original strand, 18352099 - 18352222
Alignment:
| Q |
18 |
gattgagcccttgggatctcccaagattatgttgaaggacattccaatttcccctttaccaaataaaacagatgtacctaacccatcattgcttggatta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18352099 |
gattgagcccttgggatctcccaagattatgttgaagggcattccaattttccctttaccaaataaaacagatgtacctaacccatcattgcttggatta |
18352198 |
T |
 |
| Q |
118 |
aataacttcgctaatgagagtaag |
141 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
18352199 |
aataacttcgctaatgagagtaag |
18352222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University