View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9366_low_69 (Length: 368)
Name: NF9366_low_69
Description: NF9366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9366_low_69 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 1 - 355
Target Start/End: Original strand, 16160659 - 16161008
Alignment:
| Q |
1 |
tttggtgttgccggttctgttgagagtacttccttggcctttggtgctgaacatgaatctgctttcaaggctaatggatctggtgtcaaaagaaatcttt |
100 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
16160659 |
tttggtgttgccggttctgctgagagtacttccttggccgttggtgctgaacatgaatctgctttcaa-----atggatctggtgccaaaagaaatcttt |
16160753 |
T |
 |
| Q |
101 |
cttctgcctttgttgaagttgactctgatgatgagactcttgcctagaaatatggaaggattagaaagggttgaacgtagtggttggttgtcgaactgtc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
16160754 |
cttctgcctttgttgaagttgactctgatgatgagactcttgcccagaaatatggaaggattagaaagggttgaacgcagtggttggttgtcgaactgtc |
16160853 |
T |
 |
| Q |
201 |
tgagttatcgtttgtaataatggctgcattagtgcatcaattgaaccattgtgtctatgtttgttgttgtttgcttcattttgtttggagatatggactc |
300 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
16160854 |
tgagttatcgtttgtagtaatggctgcattagtgcatcaattgaaccattgtgtctatgtttgttgttgtttgcttcattttgtttggagatgtggactc |
16160953 |
T |
 |
| Q |
301 |
cctcttatgttgttccttttgaatttttatgttgtgtgtctcttttatgtgatgt |
355 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16160954 |
cctcttatgttgttccttttgaatttttatgttgtgtgtctcttttatgtgatgt |
16161008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University