View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9366_low_73 (Length: 365)

Name: NF9366_low_73
Description: NF9366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9366_low_73
NF9366_low_73
[»] chr3 (1 HSPs)
chr3 (246-325)||(48443321-48443400)


Alignment Details
Target: chr3 (Bit Score: 76; Significance: 4e-35; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 246 - 325
Target Start/End: Original strand, 48443321 - 48443400
Alignment:
246 tttaggctataaataaatcaagtcttaggatggtttcacaccactttacactatagaatcatttgttactattttaataa 325  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
48443321 tttaggctataaataaatcaagtcttaggatggtttcacaccaatttacactatagaatcatttgttactattttaataa 48443400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University