View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9366_low_92 (Length: 329)
Name: NF9366_low_92
Description: NF9366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9366_low_92 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 295; Significance: 1e-166; HSPs: 25)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 1 - 319
Target Start/End: Original strand, 48852402 - 48852720
Alignment:
| Q |
1 |
ctattcgtctcaacttcagaacttcaaactcgatctatagatctcgaagcatcgcttaacgttgaggccgcttcactgaaccaccttacttttatgcccc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
48852402 |
ctattcgtctcaacttcagaacttcaaactctatctatagatctcgaagcatcgcttaacgttgaggccacttcactgaaccaccttacttttatgcccc |
48852501 |
T |
 |
| Q |
101 |
aatcttatctttacattcatattaatgcttcatgtagaggctttatattttttcaccgttcttcagagatttacctatggaatccatctaccggagttca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
48852502 |
aatcttatctttacattcatattaatgcttcatgtagaggctttatatttttgcaccgttcttcagagatttatctatggaatccatccaccggagttca |
48852601 |
T |
 |
| Q |
201 |
caaacaaatacctttgtctcccattgattcgaggttagatggcacatatttctgttatctatatggttttgggtatgacccgtcaaccgatgattacttg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48852602 |
caaacaaatacctttgtctcccattgattcgaggttagatggcacatatttctgttatctatatggttttgggtatgacccgtcaaccgatgattacttg |
48852701 |
T |
 |
| Q |
301 |
ttagttttaatgtcctatg |
319 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
48852702 |
gtagttttaatgtcctatg |
48852720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 176 - 278
Target Start/End: Original strand, 48891326 - 48891428
Alignment:
| Q |
176 |
tatggaatccatctaccggagttcacaaacaaatacctttgtctcccattgattcgaggttagatggcacatatttctgttatctatatggttttgggta |
275 |
Q |
| |
|
||||||||||||| || ||| ||||||||||||||||||||||||| ||||||||||||||||||| || ||||| |||||||||||||||||| |||| |
|
|
| T |
48891326 |
tatggaatccatccactggacttcacaaacaaatacctttgtctcctattgattcgaggttagatgccaactatttatgttatctatatggttttaggta |
48891425 |
T |
 |
| Q |
276 |
tga |
278 |
Q |
| |
|
||| |
|
|
| T |
48891426 |
tga |
48891428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 129 - 221
Target Start/End: Original strand, 48898586 - 48898678
Alignment:
| Q |
129 |
ttcatgtagaggctttatattttttcaccgttcttcagagatttacctatggaatccatctaccggagttcacaaacaaatacctttgtctcc |
221 |
Q |
| |
|
||||||||||||||||||| |||| || || ||||| || |||||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
48898586 |
ttcatgtagaggctttatacttttgcatacttgctcagatatccacctatggaatccatccaccggagctcacaaacaaatacctttgtctcc |
48898678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 116 - 221
Target Start/End: Complemental strand, 37827215 - 37827110
Alignment:
| Q |
116 |
ttcatattaatgcttcatgtagaggctttatattttttcaccgttcttcagagatttacctatggaatccatctaccggagttcacaaacaaataccttt |
215 |
Q |
| |
|
|||| ||||| | |||| ||||||| ||| ||||||| |||||||||| | | || ||| ||||||||||||| || ||| |||||||||||||||| || |
|
|
| T |
37827215 |
ttcaaattaaaggttcaggtagagggtttgtatttttgcaccgttctttaaacatctacatatggaatccatccactggatttcacaaacaaataccctt |
37827116 |
T |
 |
| Q |
216 |
gtctcc |
221 |
Q |
| |
|
|||||| |
|
|
| T |
37827115 |
gtctcc |
37827110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 129 - 221
Target Start/End: Complemental strand, 49044404 - 49044312
Alignment:
| Q |
129 |
ttcatgtagaggctttatattttttcaccgttcttcagagatttacctatggaatccatctaccggagttcacaaacaaatacctttgtctcc |
221 |
Q |
| |
|
|||||||||||| ||||||||||| || ||| || || | ||| |||||||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
49044404 |
ttcatgtagagggtttatatttttgcatcgtgctgcaacaacttatctatggaatccatccactagagttcacaaacaaatacctttgtctcc |
49044312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 172 - 227
Target Start/End: Complemental strand, 48170745 - 48170690
Alignment:
| Q |
172 |
tacctatggaatccatctaccggagttcacaaacaaatacctttgtctcccattga |
227 |
Q |
| |
|
||||||||||||||||| ||| ||||||| |||||||||||||||||||| ||||| |
|
|
| T |
48170745 |
tacctatggaatccatccacccgagttcataaacaaatacctttgtctcctattga |
48170690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 119 - 214
Target Start/End: Original strand, 48863086 - 48863181
Alignment:
| Q |
119 |
atattaatgcttcatgtagaggctttatattttttcaccgttcttcagagatttacctatggaatccatctaccggagttcacaaacaaatacctt |
214 |
Q |
| |
|
||||||| ||||||| |||||||||||| |||| || || ||||| | || ||||||||||||||||| ||||||| ||| ||||||||||||| |
|
|
| T |
48863086 |
atattaaagcttcatctagaggctttattgttttcaactgtgcttcaaacatctacctatggaatccatccaccggagctcagaaacaaatacctt |
48863181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 129 - 220
Target Start/End: Complemental strand, 50250998 - 50250907
Alignment:
| Q |
129 |
ttcatgtagaggctttatattttttcaccgttcttcagagatttacctatggaatccatctaccggagttcacaaacaaatacctttgtctc |
220 |
Q |
| |
|
|||||||||||| ||||||||||| ||| ||| |||| | ||||||||||||||||| ||||| |||||| ||||||||||||||||| |
|
|
| T |
50250998 |
ttcatgtagaggatttatatttttccactgtttttcaagcctctacctatggaatccatccaccgggcttcacatacaaatacctttgtctc |
50250907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 172 - 217
Target Start/End: Original strand, 48870452 - 48870497
Alignment:
| Q |
172 |
tacctatggaatccatctaccggagttcacaaacaaatacctttgt |
217 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
48870452 |
tacctatggaatccatccaccggatttcacaaacaaatacctttgt |
48870497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 172 - 221
Target Start/End: Original strand, 48875756 - 48875805
Alignment:
| Q |
172 |
tacctatggaatccatctaccggagttcacaaacaaatacctttgtctcc |
221 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||||||||||| ||||||| |
|
|
| T |
48875756 |
tacctatggaatccatccaccggatttcacaaacaaatacctatgtctcc |
48875805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 172 - 217
Target Start/End: Original strand, 48886138 - 48886183
Alignment:
| Q |
172 |
tacctatggaatccatctaccggagttcacaaacaaatacctttgt |
217 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
48886138 |
tacctatggaatccatccaccggatttcacaaacaaatacctttgt |
48886183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 130 - 212
Target Start/End: Original strand, 7822840 - 7822922
Alignment:
| Q |
130 |
tcatgtagaggctttatattttttcaccgttcttcagagatttacctatggaatccatctaccggagttcacaaacaaatacc |
212 |
Q |
| |
|
|||||| |||| ||| ||||||| |||||| | |||| ||||||||||||||||||||||| ||| || | ||||||||||| |
|
|
| T |
7822840 |
tcatgtggagggtttttatttttataccgttttccagacatttacctatggaatccatctactggatttaagaaacaaatacc |
7822922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 173 - 227
Target Start/End: Complemental strand, 33133978 - 33133924
Alignment:
| Q |
173 |
acctatggaatccatctaccggagttcacaaacaaatacctttgtctcccattga |
227 |
Q |
| |
|
||||||||||||||| ||| ||||||| |||||||||||||||||||| ||||| |
|
|
| T |
33133978 |
acctatggaatccattcacccgagttcataaacaaatacctttgtctccaattga |
33133924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 172 - 218
Target Start/End: Complemental strand, 48705524 - 48705478
Alignment:
| Q |
172 |
tacctatggaatccatctaccggagttcacaaacaaatacctttgtc |
218 |
Q |
| |
|
||||| |||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
48705524 |
tacctgtggaatccatctactggatttcacaaacaaatacctttgtc |
48705478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 256 - 296
Target Start/End: Complemental strand, 49048663 - 49048623
Alignment:
| Q |
256 |
tatctatatggttttgggtatgacccgtcaaccgatgatta |
296 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
49048663 |
tatctatatggttttgggtatgacccatcaacagatgatta |
49048623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 170 - 221
Target Start/End: Complemental strand, 49048751 - 49048700
Alignment:
| Q |
170 |
tttacctatggaatccatctaccggagttcacaaacaaatacctttgtctcc |
221 |
Q |
| |
|
||||||| ||||||||||| || ||||||||| |||||||||||||||||| |
|
|
| T |
49048751 |
tttacctttggaatccatccactagagttcacagacaaatacctttgtctcc |
49048700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 176 - 215
Target Start/End: Original strand, 50672412 - 50672451
Alignment:
| Q |
176 |
tatggaatccatctaccggagttcacaaacaaataccttt |
215 |
Q |
| |
|
||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
50672412 |
tatggaatccatccacaggagttcacaaacaaataccttt |
50672451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 130 - 212
Target Start/End: Original strand, 7800508 - 7800590
Alignment:
| Q |
130 |
tcatgtagaggctttatattttttcaccgttcttcagagatttacctatggaatccatctaccggagttcacaaacaaatacc |
212 |
Q |
| |
|
|||||| |||| ||| ||||||| |||||| | |||| |||||||| |||||||||||||| ||| || | ||||||||||| |
|
|
| T |
7800508 |
tcatgtggagggtttttatttttataccgttttccagacatttacctgtggaatccatctactggatttaagaaacaaatacc |
7800590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 130 - 212
Target Start/End: Original strand, 7813351 - 7813433
Alignment:
| Q |
130 |
tcatgtagaggctttatattttttcaccgttcttcagagatttacctatggaatccatctaccggagttcacaaacaaatacc |
212 |
Q |
| |
|
|||||| |||| ||| ||||||| |||||| | |||| |||||||| |||||||||||||| ||| || | ||||||||||| |
|
|
| T |
7813351 |
tcatgtggagggtttttatttttataccgttttccagacatttacctgtggaatccatctactggatttaagaaacaaatacc |
7813433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 176 - 230
Target Start/End: Complemental strand, 48156579 - 48156525
Alignment:
| Q |
176 |
tatggaatccatctaccggagttcacaaacaaatacctttgtctcccattgattc |
230 |
Q |
| |
|
||||||||||||| || ||||| |||||||||||||||||||||| | |||||| |
|
|
| T |
48156579 |
tatggaatccatcaactagagtttacaaacaaatacctttgtctcctaatgattc |
48156525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 262 - 300
Target Start/End: Complemental strand, 49041248 - 49041210
Alignment:
| Q |
262 |
tatggttttgggtatgacccgtcaaccgatgattacttg |
300 |
Q |
| |
|
||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
49041248 |
tatggttttgggtatgatccgtcaacagatgattacttg |
49041210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 171 - 221
Target Start/End: Complemental strand, 49041321 - 49041271
Alignment:
| Q |
171 |
ttacctatggaatccatctaccggagttcacaaacaaatacctttgtctcc |
221 |
Q |
| |
|
|||||||||||| ||||| ||||||| |||||||| |||||||||| |||| |
|
|
| T |
49041321 |
ttacctatggaacccatccaccggagctcacaaactaatacctttgcctcc |
49041271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 257 - 319
Target Start/End: Original strand, 50669047 - 50669109
Alignment:
| Q |
257 |
atctatatggttttgggtatgacccgtcaaccgatgattacttgttagttttaatgtcctatg |
319 |
Q |
| |
|
|||||||||||||||| ||||||| ||||| |||||||||||| | |||| | ||||||||| |
|
|
| T |
50669047 |
atctatatggttttggttatgaccggtcaagagatgattacttggttgtttcattgtcctatg |
50669109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 257 - 314
Target Start/End: Complemental strand, 49044276 - 49044219
Alignment:
| Q |
257 |
atctatatggttttgggtatgacccgtcaaccgatgattacttgttagttttaatgtc |
314 |
Q |
| |
|
|||||||| ||||||||||||| |||||||| |||||||| ||| | ||||| ||||| |
|
|
| T |
49044276 |
atctatattgttttgggtatgatccgtcaacagatgattatttggtggttttgatgtc |
49044219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 133 - 221
Target Start/End: Original strand, 50668923 - 50669011
Alignment:
| Q |
133 |
tgtagaggctttatattttttcaccgttcttcagagatttacctatggaatccatctaccggagttcacaaacaaatacctttgtctcc |
221 |
Q |
| |
|
|||||||||||||||||||| || ||||||| | || | | ||||||||||||| ||| || |||| ||||| ||||| |||||||| |
|
|
| T |
50668923 |
tgtagaggctttatatttttgcattgttcttccaacatctgcatatggaatccatccaccagatttcataaacagataccattgtctcc |
50669011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 60; Significance: 1e-25; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 129 - 296
Target Start/End: Original strand, 21015673 - 21015840
Alignment:
| Q |
129 |
ttcatgtagaggctttatattttttcaccgttcttcagagatttacctatggaatccatctaccggagttcacaaacaaatacctttgtctcccattgat |
228 |
Q |
| |
|
|||||||||||| ||||||||||| |||| | |||| | || ||||||||||||||||| || |||||||||||||||||||||||||||| | | | |
|
|
| T |
21015673 |
ttcatgtagagggtttatatttttgcaccatgattcaaacatctacctatggaatccatccactagagttcacaaacaaatacctttgtctcctaatagt |
21015772 |
T |
 |
| Q |
229 |
tcgaggttagatggcacatatttctgttatctatatggttttgggtatgacccgtcaaccgatgatta |
296 |
Q |
| |
|
|| |||| || || ||| | ||||||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
21015773 |
tcatatttaggtgtcaattatatatgttatctatatggttttgggtatgacccatcaacagatgatta |
21015840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 119 - 230
Target Start/End: Complemental strand, 21979868 - 21979757
Alignment:
| Q |
119 |
atattaatgcttcatgtagaggctttatattttttcaccgttcttcagagatt-tacctatggaatccatctaccggagttcacaaacaaatacctttgt |
217 |
Q |
| |
|
||||||| | |||||||||||| ||||||||||| ||| ||| |||| ||| | ||| ||||||| || ||||| ||| |||| |||||||||||||||| |
|
|
| T |
21979868 |
atattaaaggttcatgtagaggatttatatttttccactgtttttca-agactctacatatggaacccgtctactggacttcaaaaacaaatacctttgt |
21979770 |
T |
 |
| Q |
218 |
ctcccattgattc |
230 |
Q |
| |
|
|||| ||||||| |
|
|
| T |
21979769 |
ctcctcttgattc |
21979757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 258 - 300
Target Start/End: Complemental strand, 14197752 - 14197710
Alignment:
| Q |
258 |
tctatatggttttgggtatgacccgtcaaccgatgattacttg |
300 |
Q |
| |
|
||||||||| ||||||||||||| ||||||| ||||||||||| |
|
|
| T |
14197752 |
tctatatggctttgggtatgacctgtcaaccaatgattacttg |
14197710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 38; Significance: 0.000000000002; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 172 - 229
Target Start/End: Complemental strand, 42562496 - 42562439
Alignment:
| Q |
172 |
tacctatggaatccatctaccggagttcacaaacaaatacctttgtctcccattgatt |
229 |
Q |
| |
|
||||||||||||||||| | |||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
42562496 |
tacctatggaatccatccatcggacatcacaaacaaatacctttgtctcctattgatt |
42562439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 175 - 213
Target Start/End: Original strand, 29261163 - 29261201
Alignment:
| Q |
175 |
ctatggaatccatctaccggagttcacaaacaaatacct |
213 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
29261163 |
ctatggaatccatcaaccggagtccacaaacaaatacct |
29261201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 170 - 212
Target Start/End: Original strand, 29688019 - 29688061
Alignment:
| Q |
170 |
tttacctatggaatccatctaccggagttcacaaacaaatacc |
212 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
29688019 |
tttatctatggaatccatccaccggagttcacagacaaatacc |
29688061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 262 - 319
Target Start/End: Original strand, 29696203 - 29696260
Alignment:
| Q |
262 |
tatggttttgggtatgacccgtcaaccgatgattacttgttagttttaatgtcctatg |
319 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||||| | ||| ||||||||||| |
|
|
| T |
29696203 |
tatggttttgggtatgacgagtcaacagatgattacttggtgatttcaatgtcctatg |
29696260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 37; Significance: 0.000000000008; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 176 - 319
Target Start/End: Original strand, 48883712 - 48883855
Alignment:
| Q |
176 |
tatggaatccatctaccggagttcacaaacaaatacctttgtctcccattgattcgaggttagatggcacat-atttctgttatctatatggttttgggt |
274 |
Q |
| |
|
|||||||||||| || ||| ||||||||||||||||||||||||| || |||| | | ||| | |||| ||||| | |||||||||||||||| | |
|
|
| T |
48883712 |
tatggaatccatacactggatttcacaaacaaatacctttgtctcctttttattccatttcagaagt-acattatttcgatcatctatatggttttggtt |
48883810 |
T |
 |
| Q |
275 |
atgacccgtcaaccgatgattacttgttagttttaatgtcctatg |
319 |
Q |
| |
|
|||||||||||| ||||||||| || | |||| ||||||||||| |
|
|
| T |
48883811 |
atgacccgtcaagagatgattacatggtggtttcaatgtcctatg |
48883855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 175 - 213
Target Start/End: Complemental strand, 30120473 - 30120435
Alignment:
| Q |
175 |
ctatggaatccatctaccggagttcacaaacaaatacct |
213 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
30120473 |
ctatggaatccatccaccggagtccacaaacaaatacct |
30120435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000008; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 129 - 221
Target Start/End: Complemental strand, 47452115 - 47452023
Alignment:
| Q |
129 |
ttcatgtagaggctttatattttttcaccgttcttcagagatttacctatggaatccatctaccggagttcacaaacaaatacctttgtctcc |
221 |
Q |
| |
|
|||||||||||| |||||| |||| |||||||| | || ||| ||||||||||||| || |||||||||||||||||||||||| |||| |
|
|
| T |
47452115 |
ttcatgtagagggtttatacttttaagttgttcttcaaacatctacatatggaatccatccactggagttcacaaacaaatacctttgcctcc |
47452023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 129 - 215
Target Start/End: Complemental strand, 11015727 - 11015641
Alignment:
| Q |
129 |
ttcatgtagaggctttatattttttcaccgttcttcagagatttacctatggaatccatctaccggagttcacaaacaaataccttt |
215 |
Q |
| |
|
|||||||||||| |||||| |||| |||||||| | || ||||||||||||||||| || ||| |||||||||||||||||| |
|
|
| T |
11015727 |
ttcatgtagaggatttatagttttgacttgttcttcaaacatctacctatggaatccatcaactggacatcacaaacaaataccttt |
11015641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 235 - 300
Target Start/End: Complemental strand, 11024639 - 11024574
Alignment:
| Q |
235 |
ttagatggcacatatttctgttatctatatggttttgggtatgacccgtcaaccgatgattacttg |
300 |
Q |
| |
|
||||||| || ||||| |||| ||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
11024639 |
ttagatgccaaatattcatgttgtctatatggttttgggtatgaccattcaagagatgattacttg |
11024574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 129 - 214
Target Start/End: Original strand, 24310050 - 24310135
Alignment:
| Q |
129 |
ttcatgtagaggctttatattttttcaccgttcttcagagatttacctatggaatccatctaccggagttcacaaacaaatacctt |
214 |
Q |
| |
|
|||||||||||| |||||||| || | ||| |||| | |||||| ||||||||||||| ||||||||||| | ||||||||||| |
|
|
| T |
24310050 |
ttcatgtagaggttttatattgttggagtgtttttcaaacatttacgtatggaatccatccaccggagttcatagacaaatacctt |
24310135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000003; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 257 - 315
Target Start/End: Original strand, 12200299 - 12200357
Alignment:
| Q |
257 |
atctatatggttttgggtatgacccgtcaaccgatgattacttgttagttttaatgtcc |
315 |
Q |
| |
|
|||||||||||||||| ||||||| ||||| |||||||||||| | |||||| ||||| |
|
|
| T |
12200299 |
atctatatggttttggttatgaccggtcaagagatgattacttggtggttttattgtcc |
12200357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 257 - 315
Target Start/End: Original strand, 12444727 - 12444785
Alignment:
| Q |
257 |
atctatatggttttgggtatgacccgtcaaccgatgattacttgttagttttaatgtcc |
315 |
Q |
| |
|
|||||||||||||||| ||||||| ||||| |||||||||||| | |||||| ||||| |
|
|
| T |
12444727 |
atctatatggttttggttatgaccggtcaagagatgattacttggtggttttattgtcc |
12444785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 142 - 287
Target Start/End: Complemental strand, 4032105 - 4031960
Alignment:
| Q |
142 |
tttatattttttcaccgttcttcagagatttacctatggaatccatctaccggagttcacaaacaaatacctttgtctcccattgattcgaggttagatg |
241 |
Q |
| |
|
||||||||| | ||| |||||||||| || ||||||||| |||| | ||||||||||||||||||||||| ||||| ||| |||| | |||| | |
|
|
| T |
4032105 |
tttatatttatgcacagttcttcagacatacttctatggaattcatccattggagttcacaaacaaatacctttatctcctattaattccaatctagacg |
4032006 |
T |
 |
| Q |
242 |
gcacatatttctgttatctatatggttttgggtatgacccgtcaac |
287 |
Q |
| |
|
| |||| ||||| ||||||||||||||||||||| |||||| |
|
|
| T |
4032005 |
atggttgtttcggttatttatatggttttgggtatgaccagtcaac |
4031960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University