View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9367_low_10 (Length: 260)
Name: NF9367_low_10
Description: NF9367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9367_low_10 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 29947822 - 29948055
Alignment:
| Q |
1 |
tccacaattaagccacagtctcgatttagaaatcaaattctgaactcattttgtgccgagactattttttaatcaagtctttgcggagacttc----tat |
96 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
29947822 |
tccacaattatgccacagtctagatttagaaatcaaattctgaactcattttgtgccgagactattttttaatcaagtctttgcggagacttccttctat |
29947921 |
T |
 |
| Q |
97 |
cataacacatagagcatctacaagatttggttgcattctgataaggcttcaatttattacctttttatagggattaagttttggttccacnnnnnnnngt |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| || |
|
|
| T |
29947922 |
cataacacatagagcatctacaagatttggttgcattctgataaggcttcaatatattacctttttatagggattaagttttggttccacaaaaaaaagt |
29948021 |
T |
 |
| Q |
197 |
taatatatcgaagcaattatcagaatggttccat |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
29948022 |
taatatatcgaagcaattatcagaatggttccat |
29948055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University