View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9367_low_16 (Length: 227)
Name: NF9367_low_16
Description: NF9367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9367_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 56 - 212
Target Start/End: Complemental strand, 43469566 - 43469410
Alignment:
| Q |
56 |
gttcatatggaattcagagacgtgtgagaacattgaagagacttataccaaatagtgatgaatctattgggttggatggactttttagagagacagctaa |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43469566 |
gttcatatggaattcagagacgtgtgagaacattgaagagacttataccaaatagtgatgaatctattgggttggatggactttttagagagacagctaa |
43469467 |
T |
|
| Q |
156 |
ttacatattgtctttgcaaaatagagtgagtgttatgaaggttatggttgatgtatt |
212 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43469466 |
ttacatactgtctttgcaaaatagagtgagtgttatgaaggttatggttgatgtatt |
43469410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University