View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9368_1 (Length: 706)
Name: NF9368_1
Description: NF9368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9368_1 |
 | |
|
| [»] scaffold0874 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0874 (Bit Score: 277; Significance: 1e-154; HSPs: 1)
Name: scaffold0874
Description:
Target: scaffold0874; HSP #1
Raw Score: 277; E-Value: 1e-154
Query Start/End: Original strand, 346 - 682
Target Start/End: Original strand, 2 - 338
Alignment:
| Q |
346 |
catgatggggagcgttcttctcatttgagtgctgagaggagtgaattgaatgttcgtggtgtattgaaaaagagcgggagtaggtattcatttggggatt |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||| || || || || |||||||||||||||| ||||| ||||| |||||||||||||||||| |||||| |
|
|
| T |
2 |
catgatggggagcgttcttctcatttgagtactaggaagaccgagttgaatgttcgtggtggattgagaaagaacgggagtaggtattcattaggggatg |
101 |
T |
|
| Q |
446 |
ttgatcggccagataatgaagatccttattcttctttgaattctaggaggaatggatcaaatattgatgctagaatgaggaagcacgggaatggaaggaa |
545 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
102 |
ttgatcggccagataatgaagatccttattcttctttgaattctgggaggaatggatcaaatattgatgctagaatgaggaagcacgggaatggaaggaa |
201 |
T |
|
| Q |
546 |
gtttattccaaagggtgtagatgggtcggatgatgcagagcgttcttctccttcacatgcgaggaatggagcgagttttgatggcaatttcgggaataaa |
645 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
202 |
gtttattccaaagggtgtagatgggtcggatgatgcagagcgttcttctccttcacatgcgaggaatggagcgagttttgatggcaatttcgggaataaa |
301 |
T |
|
| Q |
646 |
gggagtgcaaggagggttttatccaatgatggtgatg |
682 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
302 |
gggagtgcaaggagggatttatccaacgatggtgatg |
338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University