View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9368_3 (Length: 300)
Name: NF9368_3
Description: NF9368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9368_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 2e-92; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 114 - 289
Target Start/End: Original strand, 50648418 - 50648593
Alignment:
| Q |
114 |
gttcggaactctcatgcaccagttcgatttaatattggttcagttcatttcagcaattcggttcggttcaacagtgtttttgcccatccctaagcttaca |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
50648418 |
gttcggaactctcatgcaccagttcgatttaatattggttcagttcatttcagcaattcggtttggttcaacagtgtttttgcccatccctaagcttaca |
50648517 |
T |
|
| Q |
214 |
gattcgcacacataactagttgtttttagacacctttcattgtttaaccaaagaagagagtctcatttctttctct |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50648518 |
gattcgcacacataactagttgtttttagacacctttcattgtttaaccaaagaagagagtctcatttctttctct |
50648593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 30 - 88
Target Start/End: Original strand, 50648288 - 50648346
Alignment:
| Q |
30 |
ctcagttcgttttggaccaagttcgcaagagaggttgtgtgccttctagttccttaaac |
88 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50648288 |
ctcagtttgttttggaccaagttcgcaagagaggttgtgtgccttctagttccttaaac |
50648346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 148 - 181
Target Start/End: Original strand, 23777358 - 23777391
Alignment:
| Q |
148 |
ttggttcagttcatttcagcaattcggttcggtt |
181 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |
|
|
| T |
23777358 |
ttggttcagttcatttcagcaattcagttcggtt |
23777391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University