View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9368_low_10 (Length: 220)

Name: NF9368_low_10
Description: NF9368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9368_low_10
NF9368_low_10
[»] chr5 (2 HSPs)
chr5 (63-205)||(33926161-33926303)
chr5 (79-204)||(1892738-1892863)
[»] chr1 (1 HSPs)
chr1 (63-121)||(17751624-17751682)
[»] chr3 (1 HSPs)
chr3 (76-132)||(30196659-30196715)


Alignment Details
Target: chr5 (Bit Score: 139; Significance: 7e-73; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 63 - 205
Target Start/End: Complemental strand, 33926303 - 33926161
Alignment:
63 cgccatggatgatgaagtgcgcaagatcttcagcaagttcgacaaaaacggcgatggaaaaatctcacgctcagaactcaaagaaatgcttttaacactc 162  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
33926303 cgccatggatgatgaagtgcgcaagatcttcagcaagttcgacaaaaacggcgatggaaaaatctcacgctcagaactcaaagaaatgcttttaacgctc 33926204  T
163 ggatcagaaactacatcagaagaagtgaaacgcatgatggaag 205  Q
    |||||||||||||||||||||||||||||||||||||||||||    
33926203 ggatcagaaactacatcagaagaagtgaaacgcatgatggaag 33926161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 79 - 204
Target Start/End: Complemental strand, 1892863 - 1892738
Alignment:
79 gtgcgcaagatcttcagcaagttcgacaaaaacggcgatggaaaaatctcacgctcagaactcaaagaaatgcttttaacactcggatcagaaactacat 178  Q
    ||||| || ||||||| |||||||||||| |||| ||| ||||| |||||   |||||| ||  |||||||||||| ||| || |||||  |||| ||||    
1892863 gtgcgtaacatcttcaacaagttcgacaagaacgacgacggaaagatctctgtctcagagctggaagaaatgctttcaacgcttggatccaaaacgacat 1892764  T
179 cagaagaagtgaaacgcatgatggaa 204  Q
    |  | ||||| |||||||||||||||    
1892763 ctaatgaagtaaaacgcatgatggaa 1892738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 63 - 121
Target Start/End: Complemental strand, 17751682 - 17751624
Alignment:
63 cgccatggatgatgaagtgcgcaagatcttcagcaagttcgacaaaaacggcgatggaa 121  Q
    |||||||||||| || || ||||| |||||||||||||||||||| || || |||||||    
17751682 cgccatggatgacgaggttcgcaaaatcttcagcaagttcgacaagaatggtgatggaa 17751624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 76 - 132
Target Start/End: Complemental strand, 30196715 - 30196659
Alignment:
76 gaagtgcgcaagatcttcagcaagttcgacaaaaacggcgatggaaaaatctcacgc 132  Q
    ||||| ||||||||||| | ||| ||||||||||||||||| || || |||||||||    
30196715 gaagttcgcaagatctttaacaaattcgacaaaaacggcgacgggaagatctcacgc 30196659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University