View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9369_low_18 (Length: 395)
Name: NF9369_low_18
Description: NF9369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9369_low_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 117; Significance: 2e-59; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 90 - 296
Target Start/End: Complemental strand, 47176545 - 47176330
Alignment:
| Q |
90 |
cctgcaaaaaatggccatctagtatcaa-tatccttttaaaaattatatatat--------caagtatgcaggatatgttgtcggcccttgnnnnnnnaa |
180 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||| ||||||||| |||||||||||||||||||||||||||||| || |
|
|
| T |
47176545 |
cctgcaaaaaatggccatctagtatcaagtatccttttaaaaaatatatatatatatatatcaagtatgcaggatatgttgtcggcccttgtttttttaa |
47176446 |
T |
 |
| Q |
181 |
agagaaaaaccctgtannnnnnnaagttctctttctccttcatttataagagaatgatggtttttgacttagaataatcatttttgttcatctaaacgag |
280 |
Q |
| |
|
||||| |||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
47176445 |
agagagaaaccctgtatttttttaagttcaatttctccttcatttataagagaatgatggtttttgacttagaataatcatttttgttcatctaaacggg |
47176346 |
T |
 |
| Q |
281 |
ttccacgtaaattaag |
296 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
47176345 |
ttccacgtaaattaag |
47176330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 328 - 385
Target Start/End: Complemental strand, 47176298 - 47176241
Alignment:
| Q |
328 |
atcttctgagtgcatcgttgtataattcgttattttgtgtgtcattatttgatgtcca |
385 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
47176298 |
atcttctgagtgcatcgttgtataattcgttgttttgtgtgtcattatttgatttcca |
47176241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 18 - 49
Target Start/End: Complemental strand, 47176576 - 47176545
Alignment:
| Q |
18 |
aatgataacatatagtgattttaaaggccgtc |
49 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
47176576 |
aatgataacatatagtgattttaaaggccgtc |
47176545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University