View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9369_low_33 (Length: 328)
Name: NF9369_low_33
Description: NF9369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9369_low_33 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 126; Significance: 6e-65; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 126; E-Value: 6e-65
Query Start/End: Original strand, 20 - 145
Target Start/End: Original strand, 46901381 - 46901506
Alignment:
| Q |
20 |
gcgacaaggcaagatgctgctggggtggctagtgctgagatgaggaataatcctgatgctactgctactcctggtggtgtagctgcttctgttgctgcgg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46901381 |
gcgacaaggcaagatgctgctggggtggctagtgctgagatgaggaataatcctgatgctactgctactcctggtggtgtagctgcttctgttgctgcgg |
46901480 |
T |
 |
| Q |
120 |
ctgctaggctcaatgaaaacgtgggc |
145 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
46901481 |
ctgctaggctcaatgaaaacgtgggc |
46901506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University